View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11514_low_31 (Length: 313)
Name: NF11514_low_31
Description: NF11514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11514_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 268; Significance: 1e-149; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 296
Target Start/End: Complemental strand, 8137023 - 8136733
Alignment:
| Q |
1 |
agttggcttaactgaatgaggagcttaaccacggttttcaggaaaacattttcttaagctttctttccggtatggtgataatattttgaaaacatgaggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8137023 |
agttggcttaactgaatgaggagcttaaccacggttttcaggaaaacattttcttaagctttctttccagtatggtgataatattttgaaaacatgaggg |
8136924 |
T |
 |
| Q |
101 |
ggtgaatgggtgtaattttgagaagggtaaaatttggtattttttatggcttgtaggggtaacgatataatagtaggggtttagggtaaaatttcctctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
8136923 |
ggtgaatgggtgtaattttgagaagggtaaaatttggtattttttatggcttgtaggggtaacgatataatcgt-----tttagggtaaaatttcctctt |
8136829 |
T |
 |
| Q |
201 |
tttaaacttattttgtcgaatgaaagataattgtcactctaacataacttattttgtcgcagggtcttgttgggcttttactactatggcaactct |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8136828 |
tttaaacttattttgtcgaatgaaagataattgtcactctaacataacttattttgtcgcagggtcttgttgggcttttactactatggcaactct |
8136733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 212 - 296
Target Start/End: Original strand, 7671576 - 7671660
Alignment:
| Q |
212 |
tttgtcgaatgaaagataattgtcactctaacataacttattttgtcgcagggtcttgttgggcttttactactatggcaactct |
296 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| || |||||||||||||||| ||| ||||||||||| |||| |
|
|
| T |
7671576 |
tttgtcgaatgaaagataattgcaactctaacataacttattttttcacagggtcttgttgggcgtttgctactatggcagctct |
7671660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 92 - 180
Target Start/End: Original strand, 2092800 - 2092887
Alignment:
| Q |
92 |
acatgagggggtgaatgggtgtaattttgagaagggtaaaatttggtattttttatggcttgtaggggtaacgatataatagtaggggt |
180 |
Q |
| |
|
|||||| |||||| | |||||| ||||||| |||| |||||| ||||||||| |||| |||||||||||| | |||||| || ||||| |
|
|
| T |
2092800 |
acatgatggggtggaagggtgtgattttgaaaaggttaaaata-ggtatttttgatggtttgtaggggtaagggtataattgtcggggt |
2092887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University