View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11514_low_4 (Length: 554)
Name: NF11514_low_4
Description: NF11514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11514_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 367; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 367; E-Value: 0
Query Start/End: Original strand, 172 - 538
Target Start/End: Original strand, 34466046 - 34466412
Alignment:
| Q |
172 |
gttttattcaccgaaaggttctccttctgggaacaaacaacaacacagtccttctctttctccttcttcttccccggttgtcacagttgctgttgctgct |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34466046 |
gttttattcaccgaaaggttctccttctgggaacaaacaacaacacagtccttctctttctccttcttcttccccggttgtcacagttgctgttgctgct |
34466145 |
T |
 |
| Q |
272 |
acaagctcacgttccttcaacgtttttcactatgataaatttggtagtaaaagctttacttcaagaactgcttcataccctctttcctactctctctcac |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34466146 |
acaagctcacgttccttcaacgtttttcactatgataaatttggtagtaaaagctttacttcaagaactgcttcataccctctttcctactctctctcac |
34466245 |
T |
 |
| Q |
372 |
gttctccttcacttaatcttagccctattgaaagtgtgcaatcttttcctcctataaaccctgtttcaccatctttttcttctgaatcttgttctcctat |
471 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34466246 |
gttctccttcacttaatcttagccctattgaaagtgtgcaatcttttcctcctataaaccctgtttcaccatctttttcttctgaatcttgttctcctat |
34466345 |
T |
 |
| Q |
472 |
gccgatggaagattttggtttgaaatgggatggtaatgatactcaggtgagtaaaatggctcctcct |
538 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34466346 |
gccgatggaagattttggtttgaaatgggatggtaatgatactcaggtgagtaaaatggctcctcct |
34466412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 7 - 91
Target Start/End: Original strand, 34465866 - 34465950
Alignment:
| Q |
7 |
caatgacggtttccctccgccgtaccggtatgttacagactcgccggagttacaccctttaccacaaatgccacgtcacaatgtc |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
34465866 |
caatgacggtttccctccgccgtaccggtatgttacagactcgccggagttacaccctttaccaccactgccacgtcacaatgtc |
34465950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University