View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11514_low_57 (Length: 214)
Name: NF11514_low_57
Description: NF11514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11514_low_57 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 3 - 194
Target Start/End: Complemental strand, 32735648 - 32735457
Alignment:
| Q |
3 |
gacgatgacatcatgttattaccaaccgttacctcatcttcctcaaactccatcttcaccgaattcgccatcgccatgcccgacgactccgaggaagtcg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32735648 |
gacgatgacatcatgttattaccaaccgttacctcatcttcctcaaactccatcttcaccgaattcgccatcgccatgcccgacgactccgaggaagtcg |
32735549 |
T |
|
| Q |
103 |
acgttgtcaccgccgccgtaacaaccggggatatcaaccgtcgtttcttcttatcaacaaattttttactctccctttcattgagtattcta |
194 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32735548 |
acgttgtcaccgccgccgtaaccaccggagatatcaaccgtcgtttcttcttatcaacaaattttttactctccctttcattgagtattcta |
32735457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University