View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11515_high_18 (Length: 307)
Name: NF11515_high_18
Description: NF11515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11515_high_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 271; Significance: 1e-151; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 17 - 303
Target Start/End: Complemental strand, 40108695 - 40108409
Alignment:
| Q |
17 |
aggtttgactttttcatgttatggtttacagtgttgtgtatttgttgttgttaattattatgaatgtgagttgtttgattaagatctgctttggattgag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40108695 |
aggtttgactttttcatgttatggtttacagtgttgtgtatttgttgttgttaaatattatgaatgtgagttgtttgattaagatctgctttggattgag |
40108596 |
T |
|
| Q |
117 |
gttgattaggaatttaggatatttattgcatcaattcactggtttgtgccaattcaatcctgctagttagatactgatatgactacaattttgatagagc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40108595 |
gttgattaggaatttaggatatttattgcatcaattcactggtttgtgccaattcaatcctgctagttagatactaatatgactacaattttgatagagc |
40108496 |
T |
|
| Q |
217 |
cttctgctgttagtgttcgtgagattcaatgtccgcaattatgtggtcagatacatgatatttcctcatgtgttgcctttgctactc |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
40108495 |
cttctgctgttagtgttcgtgagattcaatgtccgcaattatgtggtcagatacatgatatttcctcatgtgttgcccttgatactc |
40108409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 88 - 124
Target Start/End: Complemental strand, 40100904 - 40100868
Alignment:
| Q |
88 |
tgtttgattaagatctgctttggattgaggttgatta |
124 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
40100904 |
tgtttgattaggatctgcttttgattgaggttgatta |
40100868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University