View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11515_high_26 (Length: 262)
Name: NF11515_high_26
Description: NF11515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11515_high_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 479420 - 479636
Alignment:
| Q |
1 |
tgatcctgctgtgcatatcctactttatcaaccgtaaatattggtgcattgtttttgaagttgtgcgtgcgtacaagagggtggctaatatggatgaagg |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
479420 |
tgatcgtgctgtgcatatcctactttatcaaccgtaaatattggtgcattgtttttgaagttgtgcgtgcgtacaagagggtggctaatatggatgaagg |
479519 |
T |
 |
| Q |
101 |
gagaaacattattagaaaagaatgtattaatgttcaatgacaagcacctagtagtggttggtgctgtttgaacaccgataatgcagcgaagagtggttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
479520 |
gagaaacattattagaaaagaatgtattaatgttcaatgacaagcacctagtagtggttggtgctgtttgaacaccgataatgcagcgaagagtggttct |
479619 |
T |
 |
| Q |
201 |
cacattgttggttgtgc |
217 |
Q |
| |
|
||||| |||||||||| |
|
|
| T |
479620 |
gacattattggttgtgc |
479636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University