View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11515_high_27 (Length: 253)
Name: NF11515_high_27
Description: NF11515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11515_high_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 171
Target Start/End: Complemental strand, 20933438 - 20933252
Alignment:
| Q |
1 |
aattaatttgaaaacataataataaagaagtaaggaattgaaatgaacgagaagtagtggaagaaagaaataatgaagaacc---------------gaa |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
20933438 |
aattaatttgaaaacataataataaagaagtaaggaattgaaatgaacgagaagtagtggaagaaagaaataatgaagaaccaaaaatcttcttaccgaa |
20933339 |
T |
 |
| Q |
86 |
aaatggaatgggaataaggagtggttccaatttagggtttacacagt-actgtacggtcaacgagtcaacagtagggaacaactcaa |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20933338 |
aaatggaatgggaataaggagtggttccaatttagggtttacacagtaactgtacggtcaacgagtcaacagtagggaacaactcaa |
20933252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 182 - 233
Target Start/End: Complemental strand, 20933257 - 20933206
Alignment:
| Q |
182 |
actcaaaactagacatatatttgaacaattattctttaatggcttgtatatc |
233 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||||| ||||| |
|
|
| T |
20933257 |
actcaaaactagacatatatttgtagaattattctttaatggcttgaatatc |
20933206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University