View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11515_low_23 (Length: 296)
Name: NF11515_low_23
Description: NF11515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11515_low_23 |
 |  |
|
| [»] scaffold0147 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 20 - 296
Target Start/End: Original strand, 19904 - 20180
Alignment:
| Q |
20 |
ccttagcccagtttaaaccaccttctagtgtatgaaagcttctcagtcaaaagaagttaatagttctttcttccctaacaaaaatttgagtaagcttgtt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19904 |
ccttagcccagtttaaaccaccttctagtgtatgaaagcttctcagtcaaaagaagctaatagttctttcttccctaacaaaaatttgagtaagcttgtt |
20003 |
T |
 |
| Q |
120 |
tatgttttaacagaagttaaacaaaagtgcttttgaaaaaagcaaggcaaaatacaagaagccattactttaaaagctcatatctattgcaatattcttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20004 |
tatgttttaacagaagttaaacaaaagtgcttttgaaaaaagcaaggcaaaatacaagaagccattactttaaaagctcatatctattgcaatattcttt |
20103 |
T |
 |
| Q |
220 |
taatatttctgttttcatgagtgtctaagaagttgttccaaaccaccacagtatatattctaaaatccaaactccac |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20104 |
taatatttctgttttcatgagtgtctaagaagttgttccaaaccaccacagtctatattctaaaatccaaactccac |
20180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University