View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11515_low_35 (Length: 241)
Name: NF11515_low_35
Description: NF11515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11515_low_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 20 - 238
Target Start/End: Original strand, 52383418 - 52383635
Alignment:
| Q |
20 |
cgcaccacatctacaattgaaatcataccaactatttccccatctataactggaacatgacgaattcgattctctgcaatacaagtatagggtcacacta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
52383418 |
cgcaccacatctacaattgaaatcataccaactatttccccatctataactggaacatgacggattcgattctctgcaatacaagtatagggtcacac-a |
52383516 |
T |
|
| Q |
120 |
tgtttcttcaatatttggtcacataaattctgtagcaaaatatttatgtggaacagacagttacccaacattagtctcattgctcttagaatgttcgtgt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
52383517 |
tgtttcttcaatatttggtcacataaattctgtagcaaaatatttatgtggaacagacaattacctaacattagtctcattgctcttagaatattcgtgt |
52383616 |
T |
|
| Q |
220 |
ccgaggtcacagttaccag |
238 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
52383617 |
ccgaggtcacagttaccag |
52383635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University