View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11515_low_42 (Length: 226)

Name: NF11515_low_42
Description: NF11515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11515_low_42
NF11515_low_42
[»] chr8 (1 HSPs)
chr8 (1-226)||(33813079-33813304)


Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 33813079 - 33813304
Alignment:
1 actatatagagatacagtatcttgacttgggatattcattgtataatcacatgctaattgagctagttaacggtaatgatgaacttaattagagtacaat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33813079 actatatagagatacagtatcttgacttgggatattcattgtataatcacatgctaattgagctagttaacggtaatgatgaacttaattagagtacaat 33813178  T
101 aaattaaatatcaaaagggacgagtgaataattagttaatccttattcagctcaataaaggctgcccaaaatttcaaaatccaagaaggatcaactcgta 200  Q
    | ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33813179 atattaaatatcaaaagggacgagtgagtaattagttaatccttattcagctcaataaaggctgcccaaaatttcaaaatccaagaaggatcaactcgta 33813278  T
201 gataactagcattggtaacataaaat 226  Q
    ||||||||||||||||||||||||||    
33813279 gataactagcattggtaacataaaat 33813304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University