View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11516_high_18 (Length: 342)
Name: NF11516_high_18
Description: NF11516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11516_high_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 129 - 325
Target Start/End: Complemental strand, 36936392 - 36936196
Alignment:
| Q |
129 |
ggtcagaatcccaaacgcccaactcctaggaaagatatacttctccagtctaaatccgggtagaaatgtcctatcatgtttcaacccgacactttactat |
228 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36936392 |
ggtcagaatcccaaatgcccaactcctaggaaagatatacttctccagtctaaatccgggtagaaatgtcctatcatgtttcaacctgacactttactat |
36936293 |
T |
|
| Q |
229 |
tttatctgttttatttctcttttggtggtctttagtttagactatgtcgagtttgttgttattgcattcaatttgtcgaaaaaccctaaatgtgttt |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
36936292 |
tttatctgttttatttctcttttggtggtctttagtttagactatgtcgagtttgttgttattgtgttcaatttgtcgaaaaaccctaaatatgttt |
36936196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 19 - 133
Target Start/End: Complemental strand, 36942527 - 36942413
Alignment:
| Q |
19 |
cacagattaaacaccacaatgcccagcgatcgccatcacaaacaacaacctctcaaccacatatcctcattgaaaacctccctctctccattatcaaagc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36942527 |
cacagattaaacaccacaatgcccagcgatcgccatcacaaacaacaacctctcaaccacatatcctcattgaaaacatccctctctccattatcaaagc |
36942428 |
T |
|
| Q |
119 |
tacactcatgggtca |
133 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
36942427 |
tacactcatgggtca |
36942413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University