View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11516_high_28 (Length: 258)

Name: NF11516_high_28
Description: NF11516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11516_high_28
NF11516_high_28
[»] chr3 (1 HSPs)
chr3 (10-258)||(49378013-49378261)


Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 10 - 258
Target Start/End: Original strand, 49378013 - 49378261
Alignment:
10 aggagcacagaccataattaatgctctgtatgatgcatattgcttcttttgaagtggttcaattcatccatcaaactcaggaacaaaaccttgccatgct 109  Q
    |||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49378013 aggaacacaaaccataattaatgctctgtatgatgcatattgcttcttttgaagtggttcaattcatccatcaaactcaggaacaaaaccttgccatgct 49378112  T
110 ttgctttgatttctctaattagtaattgagattcgaaagtgacatcttatctatatggggtttcatcttgccagggcaaacttagacacttaaccaattt 209  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||    
49378113 ttgctttgatttctctaattagtaattgagattcgaaagtgacatcttatctatatggggtttcatcttgcctggccaaacttagacacttaaccaattt 49378212  T
210 agttgtaggggtgtgtgtgggtgaagtaatggatgataggtaaatggcc 258  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
49378213 agttgtaggggtgtgtgtgggtgaagtaatggatgataggtaaatggcc 49378261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University