View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11516_high_28 (Length: 258)
Name: NF11516_high_28
Description: NF11516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11516_high_28 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 10 - 258
Target Start/End: Original strand, 49378013 - 49378261
Alignment:
| Q |
10 |
aggagcacagaccataattaatgctctgtatgatgcatattgcttcttttgaagtggttcaattcatccatcaaactcaggaacaaaaccttgccatgct |
109 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49378013 |
aggaacacaaaccataattaatgctctgtatgatgcatattgcttcttttgaagtggttcaattcatccatcaaactcaggaacaaaaccttgccatgct |
49378112 |
T |
 |
| Q |
110 |
ttgctttgatttctctaattagtaattgagattcgaaagtgacatcttatctatatggggtttcatcttgccagggcaaacttagacacttaaccaattt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
49378113 |
ttgctttgatttctctaattagtaattgagattcgaaagtgacatcttatctatatggggtttcatcttgcctggccaaacttagacacttaaccaattt |
49378212 |
T |
 |
| Q |
210 |
agttgtaggggtgtgtgtgggtgaagtaatggatgataggtaaatggcc |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49378213 |
agttgtaggggtgtgtgtgggtgaagtaatggatgataggtaaatggcc |
49378261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University