View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11516_high_35 (Length: 241)
Name: NF11516_high_35
Description: NF11516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11516_high_35 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 241
Target Start/End: Original strand, 39611531 - 39611754
Alignment:
| Q |
18 |
ttttgtctgtgcattgttttgtgtaacaatgacatgccttgagtcttcaaattttttcaggaacggctaaaaccgattgcagaagattgaatttttcaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39611531 |
ttttgtctgtgcattgttttgtgtaacaattacatgccttgagtcttcaaaaaatttcaggaacggctaaaaccgattgcagaagattgaatttttcaga |
39611630 |
T |
|
| Q |
118 |
gtgaagggttttataagttgactacttgctcaaatgtacaacatttttggtagtgtaagatttggatcactttgtgttgccatgcttttggtaacttcat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
39611631 |
gtgaagggttttataagttgactacttgctcaaatgtacaacatttttggtagtgtaagatttggatcactttgtgttgccatgcttttggtaactttat |
39611730 |
T |
|
| Q |
218 |
aactgtaaatcagtgttccctttt |
241 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
39611731 |
aactgtaaatcagtgttccctttt |
39611754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University