View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11516_high_37 (Length: 237)
Name: NF11516_high_37
Description: NF11516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11516_high_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 17 - 216
Target Start/End: Complemental strand, 41894637 - 41894438
Alignment:
| Q |
17 |
agacacttcatttgagaactgattcaaggaaagaccgtgtagcgtggatacaagctttggtttcaactcgaagcttgtatccactaaacggtcatcatct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41894637 |
agacacttcatttgagaactgattcaaggaaagaccgtgtagcgtggatacaagctttggtttcaactcgaagcttgtatccactaaacggtcatcatct |
41894538 |
T |
 |
| Q |
117 |
atctcttgcaccctatcatatatctgtatcaaccgagaggctgaagaaacgtttgcttgaagagggtagcagtgaaaatcttgtgaaggagtgtgagcaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41894537 |
atctcttgcaccctatcatatatctgtatcaaccgagaggctgaagaaacgtttgcttgaagagggtagcagtgaaaatcttgtgaaggagtgtgagcaa |
41894438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 178 - 219
Target Start/End: Complemental strand, 11173537 - 11173496
Alignment:
| Q |
178 |
gagggtagcagtgaaaatcttgtgaaggagtgtgagcaatga |
219 |
Q |
| |
|
|||||||||||||| |||||||| ||||| |||||||||||| |
|
|
| T |
11173537 |
gagggtagcagtgagaatcttgtcaaggaatgtgagcaatga |
11173496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University