View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11516_low_16 (Length: 353)
Name: NF11516_low_16
Description: NF11516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11516_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 6e-99; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 146 - 335
Target Start/End: Original strand, 30732487 - 30732677
Alignment:
| Q |
146 |
agaatcaattttgtttattagtcttcattttattttatctcatttcactaataaagttataaatatttataagtagaataagacaatgggcatacaatga |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30732487 |
agaatcaattttgtttattagtcttcattttattttatctcatttcactaataaagttataaatatttataagtagaataagacaatgggcatacaatga |
30732586 |
T |
|
| Q |
246 |
atgaaataaattgttttgaatcttttaaaatgaaatttggt-aaaatttcttcacttgtttgataactcaaacaggaagcaaaccggtaaa |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30732587 |
atgaaataaattgttttgaatcttttaaaatgaaatttggtaaaaatttcttcacttgtttgataactcaaacaggaagcaaaccggtaaa |
30732677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 14 - 128
Target Start/End: Original strand, 30732236 - 30732350
Alignment:
| Q |
14 |
ggagcagagaaaggctgagtggtcaattttactcacaaacccctcaatccctgagcatttaagctnnnnnnnntctacatctttcacgacaatatgataa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30732236 |
ggagcagagaaaggctgagtggtcaattttactcacaaacccctcaatccctgagcatttaagctaaaaaaaatctacatctttcacgacaatatgataa |
30732335 |
T |
|
| Q |
114 |
agaaaagtacaataa |
128 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
30732336 |
agaaaagtacaataa |
30732350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 144 - 176
Target Start/End: Original strand, 30732395 - 30732427
Alignment:
| Q |
144 |
aaagaatcaattttgtttattagtcttcatttt |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30732395 |
aaagaatcaattttgtttattagtcttcatttt |
30732427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University