View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11516_low_18 (Length: 348)
Name: NF11516_low_18
Description: NF11516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11516_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 13 - 333
Target Start/End: Original strand, 10007737 - 10008051
Alignment:
| Q |
13 |
gaacctgtgcagattgcattttggaatagatttgtggtattttttgagtttcacagttcacagggagttgaaaacatgcaaaatattatgttgtgcgctt |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10007737 |
gaacctatgcagattgcattttggaatagatttgtggtattttttgagtttcacagttcacagggagttgaaaacatgcaaaatattatgttgtgcgctt |
10007836 |
T |
 |
| Q |
113 |
ttttatcatctggatttactgttccattgcgtccataaaccaatgtttaccactgtatactccacaaactcttaaaagattgcaggttcatccttaaatg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10007837 |
ttttatcatctggatttactgttccattgcgtccat-aaccaatgtttaccactgtatactccacaaactctt-aaagattgcaggttcatccttaaatg |
10007934 |
T |
 |
| Q |
213 |
gtaagttaccctttttatagagccattaaatatttcattcaagtaagggtttgtctcaacattttctaagatgcttttcctggtatgttctcagtaataa |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10007935 |
gtaagttaccctttttatagagccattaaata----gttcaagtaaggatttgtctcaacattttctaagatgcttttcctggtatgttctcagtaataa |
10008030 |
T |
 |
| Q |
313 |
ggattgaccagtaaagtacat |
333 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
10008031 |
ggattgaccagtaaagtacat |
10008051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University