View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11516_low_26 (Length: 290)
Name: NF11516_low_26
Description: NF11516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11516_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 268; Significance: 1e-150; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 268; E-Value: 1e-150
Query Start/End: Original strand, 1 - 272
Target Start/End: Original strand, 14588052 - 14588323
Alignment:
| Q |
1 |
agaaccactcaaattctcatcaatttcacctttcccaacagaaaagtttccaactttatcaaccccgttagatagaaaacttgcattataaccattttca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14588052 |
agaaccactcaaattctcatcaatttcacctttcccagcagaaaagtttccaactttatcaaccccgttagatagaaaacttgcattataaccattttca |
14588151 |
T |
|
| Q |
101 |
ctaaaattccccaaaagggtattctcaaaaccctgatttgaaacattaacttcagggattttactcaattgttcttgatgaattgtgaaaagaggagtga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14588152 |
ctaaaattccccaaaagggtattctcaaaaccctgatttgaaacattaacttcagggattttactcaattgttcttgatgaattgtgaaaagaggagtga |
14588251 |
T |
|
| Q |
201 |
ttgaaacgttggaggaaggagataaattggcgaatggaaaatgccattcagagaatgaagaagagttgagaa |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14588252 |
ttgaaacgttggaggaaggagataaattggcgaatggaaaatgccattcagagaatgaagaagagttgagaa |
14588323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University