View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11516_low_30 (Length: 256)
Name: NF11516_low_30
Description: NF11516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11516_low_30 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 9 - 256
Target Start/End: Complemental strand, 39612083 - 39611836
Alignment:
| Q |
9 |
agaagaaacaaccggctcaagagtcgcgactctagccaaatcagcaaaaatttgcttcacacaaatgtttttgttttacattttcattgtggcttactag |
108 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39612083 |
agaagaaacaaccggcccaagagtcgcaactctagccaaatcagcaaaaatttgcttcatacaaatgtttttgttttacattttcattgtggcttactag |
39611984 |
T |
 |
| Q |
109 |
tgtattttaaaatcaaacgatgattaatactatatttcacaaactcaatattaacatgattaaatttgcaacattttaaatgaatttaatttgacacatt |
208 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39611983 |
tgtattttaaaatcaaaagatgattaatactatatttcacaaactcaatattaacatgattaaatttgcatcattttaaatgaatttaatttgacacatt |
39611884 |
T |
 |
| Q |
209 |
atatttttagaaataggctctggcctagtgaagttgctattatatcac |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39611883 |
atatttttagaaataggctctggcctagtgaagttgctattatatcac |
39611836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University