View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11516_low_37 (Length: 240)
Name: NF11516_low_37
Description: NF11516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11516_low_37 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 240
Target Start/End: Complemental strand, 49378473 - 49378258
Alignment:
| Q |
19 |
ttaccaatagagcacaatatagtgcttgacaaagtgtacgtaaacttgtgaaacccacgtgatggtgcatggcaatggcaaattatgctattcacaaaac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
49378473 |
ttaccaatagagcacaatatagtgcttgacaaagtgtacgtaaacttgtgaaacccacgtgatggtgcatggcaa------attatgctattcactaaac |
49378380 |
T |
|
| Q |
119 |
tccgcacgaacaaaggattgaaagttggaatccagttgttctatatagttcccatgcggtgaagggtacaaactcaactagtaggacccctaaagtatta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49378379 |
tccgcacgaacaaaggattgaaagttggaatccagttgttctatatagttcccatgcggtgaagggtacaaactcaactagtaggacccctaaagtatta |
49378280 |
T |
|
| Q |
219 |
tgggtctaattcattgttggcc |
240 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
49378279 |
tgggtctaattcattgttggcc |
49378258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 156 - 229
Target Start/End: Complemental strand, 49385548 - 49385476
Alignment:
| Q |
156 |
gttctatatagttcccatgcggtgaagggtacaaactcaactagtaggacccctaaagtattatgggtctaatt |
229 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||||||| ||||||| |||| |||||||||||| |
|
|
| T |
49385548 |
gttctatatagttcccgtgcagtgaagggtacaaactcaactagtagg-cccctaaggtatgatgggtctaatt |
49385476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University