View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11518_low_8 (Length: 215)
Name: NF11518_low_8
Description: NF11518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11518_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 14 - 50
Target Start/End: Original strand, 10617195 - 10617231
Alignment:
| Q |
14 |
cataggggcattgtagtactttccaaaatagataata |
50 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10617195 |
cataggggcattgtagtactttccaaaacagataata |
10617231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 14 - 50
Target Start/End: Complemental strand, 34411501 - 34411465
Alignment:
| Q |
14 |
cataggggcattgtagtactttccaaaatagataata |
50 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
34411501 |
cataggggcattgtagtacttttcaaaacagataata |
34411465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 14 - 50
Target Start/End: Original strand, 28686481 - 28686517
Alignment:
| Q |
14 |
cataggggcattgtagtactttccaaaatagataata |
50 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
28686481 |
cataggggcattgtagtacttttcaaaataggtaata |
28686517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University