View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11518_low_8 (Length: 215)

Name: NF11518_low_8
Description: NF11518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11518_low_8
NF11518_low_8
[»] chr1 (1 HSPs)
chr1 (14-50)||(10617195-10617231)
[»] chr4 (1 HSPs)
chr4 (14-50)||(34411465-34411501)
[»] chr3 (1 HSPs)
chr3 (14-50)||(28686481-28686517)


Alignment Details
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 14 - 50
Target Start/End: Original strand, 10617195 - 10617231
Alignment:
14 cataggggcattgtagtactttccaaaatagataata 50  Q
    |||||||||||||||||||||||||||| ||||||||    
10617195 cataggggcattgtagtactttccaaaacagataata 10617231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 14 - 50
Target Start/End: Complemental strand, 34411501 - 34411465
Alignment:
14 cataggggcattgtagtactttccaaaatagataata 50  Q
    |||||||||||||||||||||| ||||| ||||||||    
34411501 cataggggcattgtagtacttttcaaaacagataata 34411465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 14 - 50
Target Start/End: Original strand, 28686481 - 28686517
Alignment:
14 cataggggcattgtagtactttccaaaatagataata 50  Q
    |||||||||||||||||||||| |||||||| |||||    
28686481 cataggggcattgtagtacttttcaaaataggtaata 28686517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University