View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11519_high_16 (Length: 402)
Name: NF11519_high_16
Description: NF11519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11519_high_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 6e-84; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 6e-84
Query Start/End: Original strand, 7 - 220
Target Start/End: Original strand, 915062 - 915275
Alignment:
| Q |
7 |
gaagcataggtctaaaccttggtgagagtcaagagttgccttagatgatgactgatgagtgtgtagtgcgcgtttctcatccataatcaaaataggcgca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
915062 |
gaagcataggtctaaaccttggtgagagtcaagagttgtcttagatgatgactggtgagtgtgtagtgcgcgtttctcatccataatcaaaataggcgca |
915161 |
T |
|
| Q |
107 |
gccttaatggtcaactgtagnnnnnnnnnnnngaccatgttattggtgtgaagtatccaagtcaagttccacttggaccagcataatgttgctattgcct |
206 |
Q |
| |
|
|||||||| ||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
915162 |
gccttaattgtcaactgtagtttttcttttttgaccatgctattggtgtgaagtatccaagtcaagttccacttggaccagcataatgttgctattgcca |
915261 |
T |
|
| Q |
207 |
attatagttggtat |
220 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
915262 |
attatagttggtat |
915275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 253 - 402
Target Start/End: Original strand, 915329 - 915478
Alignment:
| Q |
253 |
tttaataatcatttaatgttctgctttgtttatggttgagagctttggcaagatacttttgtgatataattttggttattgatttatgttgaccctctta |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
915329 |
tttaataatcatttaatgttctgctttgtttatggttgagagctttggcaagatacttttgtgatataattttggttattgatttatgttgaccctctta |
915428 |
T |
|
| Q |
353 |
gtaaaatattgatccaacttgtttagtgggagtaacttaagatctcactc |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
915429 |
gtaaaatattgatccaacttgtttagtgggagtaacttaagatctcactc |
915478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University