View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11519_high_26 (Length: 331)
Name: NF11519_high_26
Description: NF11519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11519_high_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 1 - 323
Target Start/End: Original strand, 35523 - 35845
Alignment:
| Q |
1 |
tctttggttctctatggtcgccaatttgtctatcactgccatgaattttagcctaatgctaaactctgttggattctaccaagtattattctttcgttct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35523 |
tctttggttctctatggtcgccaatttgtctatcactgccatgaattttagcctaatgctaaactctgttggattctaccaagtatttttctttcgttct |
35622 |
T |
|
| Q |
101 |
ttctttattcatcaactactttcattcagtttttatatgtattttgtaaggaccttcatacttggataacaacccatatgatatacacctaggatataaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35623 |
ttctttattcatcaactactttcattcagtttttatatgtattttgtaaggaccttcatacttggataacaacccatatgatatacacctaggatataaa |
35722 |
T |
|
| Q |
201 |
gttgttaattataaccttttatcacttgattgaaatcacttgtccctttttgtctcctttcatgtctattcttttgaaaaatgacaatttgtcacattgt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35723 |
gttgttaattataaccttttatcacttgattgaaatcacttgtccctttttgtctcctttcatgtctattcttttgaaaaatgacaatttgtgacattgt |
35822 |
T |
|
| Q |
301 |
tttcaaactcgtatgttcatctc |
323 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
35823 |
tttcaaactcgtatgttcatctc |
35845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University