View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11519_low_26 (Length: 357)
Name: NF11519_low_26
Description: NF11519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11519_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 260; Significance: 1e-145; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 63 - 347
Target Start/End: Complemental strand, 40948487 - 40948207
Alignment:
| Q |
63 |
atacatacataataatgatttatcaaaatgactctaaaatcaacattaagctaaaagaacttcaaaaactacatacaatcgtagactagttaagtagtat |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40948487 |
atacatacataataatgatttatcaaaatgactctaaaatcaacattaagctaaaagaacttcaaaaactacatacaatcgtagactagttaagtagtac |
40948388 |
T |
|
| Q |
163 |
taaacattgatacacaatattgaaccaaaaactgaaaataatctcaataaatattcaagtaggcatagcataaattgtttttagccattttacaatacaa |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40948387 |
taaacattgatacacaatattgaaccaaaaactgaaaataatctcaataaatattcaagtaggcatagcataaattgtttgtagccattttacaatacaa |
40948288 |
T |
|
| Q |
263 |
tcgtggtgaaatatatgaccgcatgccattgttgaaaccttcacgtgtcatcactatcatcaccatcaccgtcttccaattcatc |
347 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40948287 |
tcgtggtgaa----atgaccgcatgccattgttgaaaccttcacgtgtcatcactatcatcaccatcaccgtcttccaattcatc |
40948207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 40945540 - 40945494
Alignment:
| Q |
1 |
tgtttttgggatagctgcttcatcggatttatggaatacaagaaaag |
47 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40945540 |
tgtttttgggatagctgcttcatcaaatttatggaatacaagaaaag |
40945494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 308
Target Start/End: Complemental strand, 40634645 - 40634605
Alignment:
| Q |
268 |
gtgaaatatatgaccgcatgccattgttgaaaccttcacgt |
308 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
40634645 |
gtgaaatatatgaccgcatggcattgttgacaccttcacgt |
40634605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University