View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11519_low_28 (Length: 327)
Name: NF11519_low_28
Description: NF11519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11519_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 307
Target Start/End: Complemental strand, 33503668 - 33503368
Alignment:
| Q |
1 |
agaaaagaagttaactgcaaaaaccactcaagaacaggatgatatccctcttttttattcagacatcatgcccctccttgtaagaacattttcttcttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33503668 |
agaaaagaagttaactgcaaaaaccactcaagaacaggatgatatccctcttttttattcagacatcatgcccctccttgtaagaacattttcttcttca |
33503569 |
T |
 |
| Q |
101 |
ttttttaaattttgaaaccaagccagattgatacaggtacattgaaattgaatatttatgattttaggtccaaagtgtaactggttacttactcttactt |
200 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33503568 |
tttttaaaaatttgaaaccaagccagattgatacaagtacattgaa------tatttatgattttaggtccaaagtgtaactggttacttactcttactt |
33503475 |
T |
 |
| Q |
201 |
tgtacaacttgctttctaatcatattgcataaattatctcaccaggttactaatgagccaactgttggagaggatgcatttgtatggttgggatcattag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33503474 |
tgtacaacttgctttctaatcatattgcataaattatctcaccaggttactaatgagccaactgttggagaggatgcatttgtatggttgggatcattag |
33503375 |
T |
 |
| Q |
301 |
ttccatt |
307 |
Q |
| |
|
||||||| |
|
|
| T |
33503374 |
ttccatt |
33503368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University