View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11519_low_38 (Length: 263)
Name: NF11519_low_38
Description: NF11519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11519_low_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 12 - 245
Target Start/End: Original strand, 40363184 - 40363417
Alignment:
| Q |
12 |
atgaaatcactagtattaaattaaaaacgcgaacgagataagcatattagtacaatattttaatcatagctaggaaatatgcaagcatctaatacatcac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40363184 |
atgaaatcactagtattaaattaaaaacgcgaacgagataagcatattagtacaatattttaatcatagctaggaaatatgcaagcatctaatacatcac |
40363283 |
T |
 |
| Q |
112 |
tggataatcctctggcgttcaatggatgtagcaaagaaatggaaattaactgattcagagtattcactacttagttaaaaatgatcagcatagtcttgtt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40363284 |
tggataatcctctggcgttcaatggatgtagcaaagaaatggaaattaactgattaagaatattcactacttagttaaaaatgatcagcatagtcttgtt |
40363383 |
T |
 |
| Q |
212 |
catgatcttgtacatttgaagagacttcaatgtt |
245 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
40363384 |
catgatcttgtacatttgaagagacctcaatgtt |
40363417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University