View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11519_low_48 (Length: 239)
Name: NF11519_low_48
Description: NF11519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11519_low_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 23 - 223
Target Start/End: Complemental strand, 43171000 - 43170800
Alignment:
| Q |
23 |
tgttgaaaattcactatagaacagtgtttggaattgaaaattatcaatttctcctcatctctaatttttgaagtcacaggaaaaacttaaaacattgtta |
122 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43171000 |
tgttgaaaattcactatagaacggtgtttggaattgaaaattatcaatttctcctcatctctaatttttgaagtcacaggaaaaacttaaaacattctta |
43170901 |
T |
 |
| Q |
123 |
taatcatttatttgttagtctttttcatgcatatctaaataaaagtctggataaacaggaaaataaattggctcttatatgcttgttgtccttgtggctt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43170900 |
taatcatttatttgttagtctttttcatgcatatctaaataaaagtctggataaacaggaaaatcaattggctcttatatgcttgttgtccttgtggctt |
43170801 |
T |
 |
| Q |
223 |
g |
223 |
Q |
| |
|
| |
|
|
| T |
43170800 |
g |
43170800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University