View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11519_low_54 (Length: 217)
Name: NF11519_low_54
Description: NF11519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11519_low_54 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 7e-82; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 17107946 - 17107789
Alignment:
| Q |
1 |
ttaagcaaaaatccccaaacacagtttcagctaagtcatgaaataaatcatgcatgataaaataatttttatatttttctgatggttggaaaaatgatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17107946 |
ttaagcaaaaatccccaaacacagtttcagctaagtcatgaaataaatcatgcatgataaaataatttttatatttttctgatggttggaaaaatgatat |
17107847 |
T |
 |
| Q |
101 |
tgacagtagatggttaaagaacgactcacccttcttttgtccagggagaaagttttca |
158 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17107846 |
tgacagtagatggttaaagtacgactcacccttcttttgtccagggagaaagttttca |
17107789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 126 - 217
Target Start/End: Complemental strand, 17107791 - 17107700
Alignment:
| Q |
126 |
tcacccttcttttgtccagggagaaagttttcagccgtccatagtaaaattaaatcatccttgtcaaataggtagcctttagggaataatgc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17107791 |
tcacccttcttttgtccagggagaaagttttcagccgtccatagtaaaattaaatcatccttgtcaaataggtagcctttagggaataatgc |
17107700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University