View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11520_high_11 (Length: 276)
Name: NF11520_high_11
Description: NF11520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11520_high_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 261
Target Start/End: Original strand, 34085128 - 34085388
Alignment:
| Q |
1 |
cgaaaatcttcatacggctccttggattccttctcaacggcaatgctatctatgagttttgtagccggctttaaaatcctataattattattgttgtcgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34085128 |
cgaaaatcttcatacggctccttggattccttctcaacggcaatgctatctatgagttttgtagccggctttaaaatcctataattattattgttgtcgt |
34085227 |
T |
|
| Q |
101 |
ttgagatggtggtggaagtgaaatctttgtcaccggtgttggcgtcgtgggaagtggtgggagaagtgagggtattagggtttgtgttttggttaaagga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34085228 |
ttgagatggtggtggaagtgaaatctttgtcatgggtgttggcgtcgtgggaagtggtgggagaagtgagggtattagggtttgtgttttggttaaagga |
34085327 |
T |
|
| Q |
201 |
gattttaggtttttgagagggttcaagtacgttagagggttttattttgatgcaaccacag |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34085328 |
gattttaggtttttgagagggttcaagtacgttagagggttttattttgatgcaaccacag |
34085388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University