View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11520_high_12 (Length: 249)
Name: NF11520_high_12
Description: NF11520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11520_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 36588290 - 36588531
Alignment:
| Q |
1 |
caggctctgcaaatggttccatttttcgtgcaaacaaagtcatgaaaaccttctcaaaaatactgtcatcgtaacgtgtcttttgtcctaaaggagcagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || |
|
|
| T |
36588290 |
caggctctgcaaatggttccatttttcgtgcaaacaaagtcatgaaaaccttctcaaaaatactgtcattgtaacgtgtcttttgtcctaaaggagctgg |
36588389 |
T |
 |
| Q |
101 |
ttcaccagatggttcagctataccacaccgaatagtagcaccacttgctcttggagcatattgtggtggag---ttattagctgaggcacaacctgaaaa |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36588390 |
ttcaccagatggttcagctataccacaccgaatggtagcaccacttgctcttggagcatattgtggtggagttattattagctgaggcacaacctgaaaa |
36588489 |
T |
 |
| Q |
198 |
ctaagaactaccattgattaattcacactcttgagtttcatc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36588490 |
ctaagaactaccattgattaattcacactcttgagtttcatc |
36588531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University