View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11520_low_8 (Length: 337)
Name: NF11520_low_8
Description: NF11520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11520_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 6e-62; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 21 - 145
Target Start/End: Complemental strand, 29238123 - 29237999
Alignment:
| Q |
21 |
tgtcttgccttcaatggccatgttaatacaggcaaatatgttatggttgatgagtataaatttccagatccatttttgtttcatacttcttgcagccact |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29238123 |
tgtcttgccttcaatggccatgttaatacaggcaaatatgttatggttgatgagtataaatttccagatccatttttgtttcatacttcttgcagccact |
29238024 |
T |
 |
| Q |
121 |
ttgtcttattgttctttaagcatac |
145 |
Q |
| |
|
|||||||||| |||||||||||||| |
|
|
| T |
29238023 |
ttgtcttattattctttaagcatac |
29237999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 160 - 272
Target Start/End: Complemental strand, 29238026 - 29237914
Alignment:
| Q |
160 |
actttgtcttattattctttaagcatactgcatacatgcattgtcctacaaaatcaaattccttccaaatctcaatccaaaactcgacgtagcggattga |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
29238026 |
actttgtcttattattctttaagcatactgcatacatgcattgtcctacaaaatcaaattccttccaaatctcaatccaaaactggacatagcggattga |
29237927 |
T |
 |
| Q |
260 |
gagtttgtcttaa |
272 |
Q |
| |
|
||||||||||||| |
|
|
| T |
29237926 |
gagtttgtcttaa |
29237914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 271 - 327
Target Start/End: Complemental strand, 29237879 - 29237823
Alignment:
| Q |
271 |
aaaagtaacgttaggagataacactgtagattgattatataaacactgtggtctgtg |
327 |
Q |
| |
|
||||||||||||||| |||||| |||||| |||||||| |||| ||||||||||||| |
|
|
| T |
29237879 |
aaaagtaacgttaggggataacgctgtaggttgattatgtaaaaactgtggtctgtg |
29237823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University