View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11521_low_18 (Length: 204)

Name: NF11521_low_18
Description: NF11521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11521_low_18
NF11521_low_18
[»] chr4 (1 HSPs)
chr4 (1-187)||(1395729-1395914)


Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 187
Target Start/End: Complemental strand, 1395914 - 1395729
Alignment:
1 cttgttgaagaattcagaagtccaagcatgcaaagggacgcctgaaacccggagccataagtacctatttaatttaacaaattgtggatgctaatcttca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1395914 cttgttgaagaattcagaagtccaagcatgcaaagggacgcctgaaacccggagccataagtacctatttaatttaacaaattgtggatgctaatcttca 1395815  T
101 aacgcaacgaaaaaataactgaagaattattttgcttcattattaatacatgaacacatgtttccccccatcggtgcaatttgtaaa 187  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||    
1395814 aacgcaacgaaaaaataactgaagaattattttgcttcattattaatacatgaacacatgtttc-ccccatcggtgcaattcgtaaa 1395729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University