View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11521_low_5 (Length: 481)
Name: NF11521_low_5
Description: NF11521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11521_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 2e-68; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 119 - 270
Target Start/End: Original strand, 44825204 - 44825355
Alignment:
| Q |
119 |
gagaagcaatctaaagattttcttctaggagaattgacttgctttcctgaaggtcatatagtatacaatgttgtcatgtctcagaatttagtatatacct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
44825204 |
gagaagcaatctaaagattttcttctaggagaattgacttgctttcctgaaggtcatatagtatacaatgttgtcatgtctcagaatttagtatatgctt |
44825303 |
T |
 |
| Q |
219 |
taggaagaattttgtttgatattgaataattgcatcccaaccattaaagctt |
270 |
Q |
| |
|
| |||||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
44825304 |
tgggaagaattttgtttgatattggataattgcatcccaagcattaaagctt |
44825355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 373 - 461
Target Start/End: Original strand, 44826653 - 44826737
Alignment:
| Q |
373 |
ggtggtggttctcttagcacgtaagtgttactaccaggatatataactattatatctactttcaattattgcaactataaacaaatgaa |
461 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||||| ||||||||| | ||||||||||||||||||||| |
|
|
| T |
44826653 |
ggtggtggttctcttagcgcgtaagtgttactaccagg----ataactattatatttactttcaacttttgcaactataaacaaatgaa |
44826737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 328 - 372
Target Start/End: Original strand, 44825843 - 44825887
Alignment:
| Q |
328 |
taatagtattcttaggaacacacgattcctgggaatattatctta |
372 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44825843 |
taataggattcttaggaacacacgattcctgggaatatgatctta |
44825887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University