View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11522_high_2 (Length: 311)
Name: NF11522_high_2
Description: NF11522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11522_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 1 - 295
Target Start/End: Original strand, 48975270 - 48975564
Alignment:
| Q |
1 |
tgagttcagattgcaggtatttatagttggaaaaacaagcttaattactacacttcgatgtgaaatccgaaaaaaccatttacattgtttaattgcaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
48975270 |
tgagttcagattgcaggtatttatagttggaaaaacaagcttaattactacacttcgatgtgaaatccaaaaaaaccatttacattgtttaattgcaaat |
48975369 |
T |
 |
| Q |
101 |
tgttgtggcgtagttcttgttttactcttgccgtcctctcatgtagatgtccttccctcttggccaacattcttacattcccctttcggcttatttccaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48975370 |
tgttgtggcgtagttcttgttttactcttgccgtcctctcatgtagatgtccttccctcttggccaacattcttacattcccctttcggcttctttccaa |
48975469 |
T |
 |
| Q |
201 |
tgccaatgatttaattcggttatgtattacagtatctaacacaaacaccaggtcaaaggacatgtgatggttacgttggggcctcagccacactt |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48975470 |
tgccaatgatttaattcggttatgtattacagtatctaacacaaacaccaggtcaaaggacatgtgatggttacgttggggcctcagccacactt |
48975564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University