View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11522_high_5 (Length: 242)
Name: NF11522_high_5
Description: NF11522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11522_high_5 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 19 - 242
Target Start/End: Original strand, 6431701 - 6431924
Alignment:
| Q |
19 |
gctccttacagtgtctgcattataaaatcatgtatcttttgtgcagataaaatggagcaaccaaatagatttattcatacagatttcattatcatacatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6431701 |
gctccttacagtgtctgcattataaaatcatgtatcttttgtgcagataaaatggagcaaccaaatagatttattcatacagatttcattatcatacatg |
6431800 |
T |
|
| Q |
119 |
ataacagattgcacatttcctctcnnnnnnngaaagaaagattgcacattacaactataccccaacaattaaaattgtaccgttacaacttcaannnnnn |
218 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6431801 |
ataacagattgcacatttcctctcaaaaaaagaaagaaagattgcacattacaactataccccaacaattaaaattgtaccgttacaacttcaatttttt |
6431900 |
T |
|
| Q |
219 |
naaagacagggacagcttggtatt |
242 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
6431901 |
taaagacagggacagcttggtatt |
6431924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University