View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11523_high_27 (Length: 302)
Name: NF11523_high_27
Description: NF11523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11523_high_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 18 - 287
Target Start/End: Complemental strand, 54202273 - 54202004
Alignment:
| Q |
18 |
gtgttgaggtggtgacataatttgattcaaatttaattggtgtgtagatccttctgtgtctgaaaaatcagtttcagattggtatgatcttggagaatat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54202273 |
gtgttgaggtggtgacataatttgattcaaatttaattggtgtgtagatccttctgtgtctgaaaaatcagtttcagattggtatgatcttggagaatat |
54202174 |
T |
|
| Q |
118 |
agaacactatctgtgtctgtttggttactaggtttgaacttgtgaagcaagtgcaaaggtgatgttccttggcttggtgttgtgtctccactcactgaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54202173 |
agaacactatctgtgtctgtttggttactaggtttgaacttgtgaagcaagtgcaaaggtgatgttccttggcttggtgttgtgtctccactcactgaag |
54202074 |
T |
|
| Q |
218 |
gaatctctattgatcctgcattccttaacttcctcttatctcttgctgccttttgccattttttaagtgc |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54202073 |
gaatctctattgatcctgcattccttaacttcctcttatctcttgctgccttttgccattttttaagtgc |
54202004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University