View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11523_low_11 (Length: 449)
Name: NF11523_low_11
Description: NF11523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11523_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 1e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 11 - 156
Target Start/End: Original strand, 9144488 - 9144635
Alignment:
| Q |
11 |
cacagaaccaaaagagttactagagtctaacacttccgctcaccttcccattaaactaaactccaataattaccctgcttggtataaacaaattcatt-- |
108 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9144488 |
cacagaaccaaaagagttactagagtccaatacttccactcaccttcccattaaactaaactcctctaattaccctgcttggtataaacaaattcattcc |
9144587 |
T |
 |
| Q |
109 |
ctccttgttgcacgtgaccttgttggatatgtcactggtgacacccct |
156 |
Q |
| |
|
|| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9144588 |
cttcttgttgcacgtgaccttattggatatgtcactggtgacacccct |
9144635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 49 - 142
Target Start/End: Complemental strand, 20251647 - 20251552
Alignment:
| Q |
49 |
ctcaccttcccattaaactaaactccaataattaccctgcttggtataaacaaattcattctc--cttgttgcacgtgaccttgttggatatgtca |
142 |
Q |
| |
|
||||||||||||| ||||| ||||| ||||| || ||||||||||| |||||| |||||| |||||||||| ||||||||| |||||||||| |
|
|
| T |
20251647 |
ctcaccttcccatcaaacttaactcttccaattatccagcttggtataatcaaattgattctcttcttgttgcacatgaccttgtgggatatgtca |
20251552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 152
Target Start/End: Complemental strand, 23902293 - 23902253
Alignment:
| Q |
112 |
cttgttgcacgtgaccttgttggatatgtcactggtgacac |
152 |
Q |
| |
|
|||||| |||||||||||||||||||||| | ||||||||| |
|
|
| T |
23902293 |
cttgtttcacgtgaccttgttggatatgtgattggtgacac |
23902253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University