View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11523_low_34 (Length: 242)
Name: NF11523_low_34
Description: NF11523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11523_low_34 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 27099055 - 27099282
Alignment:
| Q |
1 |
cggcactctcccttgtgatcgcggttattttgcggtggaagttccggtgacagccgcaggctgcacattggaggctgtttaccgcggatggcgatgagtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27099055 |
cggcactctcccttgtgatcgcggttattttgcggtggaagttccggtgacagccgcaggctgcacattggaggctgtttaccgcggatggcgatgagtc |
27099154 |
T |
|
| Q |
101 |
atcgatggtgaattcaccgcagccgtcggtggcgtagcttccaaggcttgctgcatggtttcttaaacactctctgtagatatagttttgtgaatgtgat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27099155 |
gtcgatggtgaattcaccgcagccgtcggtggcgtagcttccaaggcttgctgcatggtttcttaaacactctctgtagatatagttttgtgaatgtgat |
27099254 |
T |
|
| Q |
201 |
gatgaagatgataacattcctcctcctt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
27099255 |
gatgaagatgataacattcctcctcctt |
27099282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University