View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11523_low_38 (Length: 210)
Name: NF11523_low_38
Description: NF11523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11523_low_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 8e-91; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 18 - 194
Target Start/End: Original strand, 41296576 - 41296752
Alignment:
| Q |
18 |
gttacatacgcgtcctaagtaacaactataaatagagcatgtccttaatgctcttctctcaaaacaaaaatattacattacatctcttcttctaagtaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41296576 |
gttacatacgcgtcctaagtaacaactataaatagagcatgtccttaatgctcttctctcaaaacaaaaatattacattacatctcttcttctaagtaga |
41296675 |
T |
 |
| Q |
118 |
gaccaaacaacatatttaacatgtcagagacacttcgtttggctgttgctgttcttggtatttcttcgttcgttcat |
194 |
Q |
| |
|
||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41296676 |
gactaaacaacaaatttaacatgtcagagacacttcgtttggctgttgctgttcttggtatttcttcgttcgttcat |
41296752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 102 - 192
Target Start/End: Original strand, 41306421 - 41306511
Alignment:
| Q |
102 |
tcttcttctaagtagagaccaaacaacatatttaacatgtcagagacacttcgtttggctgttgctgttcttggtatttcttcgttcgttc |
192 |
Q |
| |
|
|||||||||||||||||| ||| |||| ||| || |||||| | ||||||||| ||||||||||||||||||||||| |||||| |||| |
|
|
| T |
41306421 |
tcttcttctaagtagagagtaaaaaacaaattaaagatgtcaaatacacttcgtctggctgttgctgttcttggtattatttcgtttgttc |
41306511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 23 - 74
Target Start/End: Original strand, 41306341 - 41306392
Alignment:
| Q |
23 |
atacgcgtcctaagtaacaactataaatagagcatgtccttaatgctcttct |
74 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||| |||| |||||| |
|
|
| T |
41306341 |
atacgcgtcctacataacgactataaatagagcatgtcctcaatgttcttct |
41306392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University