View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11523_low_39 (Length: 208)
Name: NF11523_low_39
Description: NF11523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11523_low_39 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 59 - 100
Target Start/End: Complemental strand, 12607473 - 12607432
Alignment:
| Q |
59 |
acacatttgcatctcttcactgtttctatgagtgaaactgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12607473 |
acacatttgcatctcttcactgtttctatgagtgaaactgaa |
12607432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University