View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11525_low_13 (Length: 399)
Name: NF11525_low_13
Description: NF11525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11525_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 18 - 324
Target Start/End: Original strand, 43764468 - 43764774
Alignment:
| Q |
18 |
catgcatggaatgtagannnnnnnaagttgtgtgtctttgactgtggccgccttttgaaagtggatgactttgtcgtggataaagttcgttttgattacg |
117 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43764468 |
catgcatggaatgtagatttttttaagttgtgtgtctatgactgtggccgccttttcaaagtggatgactttaccgtggataaagttcgttttgattacg |
43764567 |
T |
 |
| Q |
118 |
cgcgtgttctaatatcaacgccgtcactagaaattatcaattttgaagctaaggtgttggtggatggtgaacttcttggttttacaattgtcgaggagtg |
217 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
43764568 |
cccgtgttctaatatcaacgccgtcactagaaattatcaattctgaagctaaggtgttggtggatggtgaacttcttgattttacaattgtcgagaagtg |
43764667 |
T |
 |
| Q |
218 |
gggctttgctttaggggaggatgcttgtttgggggactatgctgagtctgacattgaaaacgacaatcagctagatgggattaatgaggaggtggctgct |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |||||||||||||||||||||||||||||| |
|
|
| T |
43764668 |
gggctttgctttaggggaggatgcttgtttgggggactatgctgagtctgacattgaaaacaacgatcatctagatgggattaatgaggaggtggctgct |
43764767 |
T |
 |
| Q |
318 |
agtgggg |
324 |
Q |
| |
|
||||||| |
|
|
| T |
43764768 |
agtgggg |
43764774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 326 - 391
Target Start/End: Original strand, 43769513 - 43769578
Alignment:
| Q |
326 |
aagtggatgttcttttgaaccatctatccgaacaatggcagcataaggataatagtgttgatgtcc |
391 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
43769513 |
aagtggatgttcttttgaaccatctatccgaacaatggaagcagaaggataatagtgttgatgtcc |
43769578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 168 - 249
Target Start/End: Original strand, 13153292 - 13153371
Alignment:
| Q |
168 |
aaggtgttggtggatggtgaacttcttggttttacaattgtcgaggagtggggctttgctttaggggaggatgcttgtttgg |
249 |
Q |
| |
|
||||| ||||||||||| |||||||||| |||| |||||| |||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
13153292 |
aaggttttggtggatggagaacttcttgactttaaaattgttgaggagggggggtt--ctttaggggaggatgcttgtttgg |
13153371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University