View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11525_low_16 (Length: 302)
Name: NF11525_low_16
Description: NF11525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11525_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 7 - 288
Target Start/End: Complemental strand, 45378524 - 45378243
Alignment:
| Q |
7 |
ttattaattgtatatgagagagggaccattcctattgtttagaaagaattccacttgcatacgccaaatacctaggtagtttgaacctcaacaaacttta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
45378524 |
ttattaattgtatatgagagagggaccattcctattgtttagaaagaattgcacttgcatacgccaaatacctatgtagtttgaacctgaacaaacttta |
45378425 |
T |
|
| Q |
107 |
ctcgtttaaccgttttctcagttatcttcatcttaaatcaaatcgtctctgcttcttgctataatcaatcaaatcagattatttgggagatatagtcaca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45378424 |
ctcgtttaaccgttttctcagttatcttcatcttaaatcaaatcgtctctgcttcttgctataatcaatcaaatcagattatttgggagatatagtcaca |
45378325 |
T |
|
| Q |
207 |
cacacatatgactaaattgtggactttgatcacccagcttcattcccttgctgggtatatgcacttttgaacaacctctttt |
288 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45378324 |
cacacatatgactaagttgtggactttgatcacccagcttcattcccttgctgggtatatgcacttttgaacaacctctttt |
45378243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University