View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11525_low_17 (Length: 302)
Name: NF11525_low_17
Description: NF11525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11525_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 3e-88; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 45378506 - 45378693
Alignment:
| Q |
1 |
tctcatatacaattaataataaataatgtttgtgatgagatgaatcgagggacacgtggaaagagaagagttggtattggattctgccttggacgtgtca |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45378506 |
tctcatatacaattaat---aaataatgtttctgatgaaatgaatcgagggacacgtggaaagagaagagttggtattggattctgccttggacgtgtca |
45378602 |
T |
|
| Q |
101 |
tatttagtttagcaccgtccagataataaataatatgtcatcttatttagtttgtttcatgattaggtcaatttttatgaaaggttatttg |
191 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45378603 |
tatttagtttagcaccgtccagatgataaataatatgtcatcttatttagtttgtttcatgattaggtcaatttttatgaaaggttatttg |
45378693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 185 - 288
Target Start/End: Complemental strand, 45378346 - 45378243
Alignment:
| Q |
185 |
ttatttgggagatatagtcacacacacatatgactaaattgtggactttgatcacccagcttcattcccttgctgggtatatgcacttttgaacaacctc |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45378346 |
ttatttgggagatatagtcacacacacatatgactaagttgtggactttgatcacccagcttcattcccttgctgggtatatgcacttttgaacaacctc |
45378247 |
T |
|
| Q |
285 |
tttt |
288 |
Q |
| |
|
|||| |
|
|
| T |
45378246 |
tttt |
45378243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University