View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11526_low_10 (Length: 227)
Name: NF11526_low_10
Description: NF11526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11526_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 46357421 - 46357204
Alignment:
| Q |
1 |
caaacagtccaaaaaccaaggagaaattaacgaatcaaaaccttaatcctaaaaacccaacaaacttctttcaaatacgatcaatgggcaactgctataa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46357421 |
caaacagtccaaaaaccaaggagaaattaacaaatcaaaaccttaatcctaaaaacccaacaaacttctttcaaatacgatcaatgggcaactgctataa |
46357322 |
T |
 |
| Q |
101 |
aaccatctacctttgnnnnnnntaattgatattcattcatataacgtgaccaatacaactacatgttgagaagtcttttgtgacgccgcagacctcttac |
200 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46357321 |
aaccatctacc-ttgaaaaaaaaaattgatattcattcatataacgtgaccaatataactacatgttgagaagtcttttgtgacgccgtagacctcttac |
46357223 |
T |
 |
| Q |
201 |
cccaagacaagttcatctc |
219 |
Q |
| |
|
|||||||||| |||||||| |
|
|
| T |
46357222 |
cccaagacaaattcatctc |
46357204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University