View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11526_low_4 (Length: 274)
Name: NF11526_low_4
Description: NF11526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11526_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 262
Target Start/End: Original strand, 49794438 - 49794682
Alignment:
| Q |
18 |
gtacttgtttagaataacaataaactcaaagtcacaaatacaagatggtatactgacttttgatttagaaaataatgaagcacttgcttttatannnnnn |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49794438 |
gtacttgtttagaataacaataaactcaaagtcacaaatacaagatggaatactgacttttgatttagaaaataatgaagcacttgcttttatatttttt |
49794537 |
T |
|
| Q |
118 |
nggtgaatggtgcatcactaagtatgtctttagaaccacgataggatgaagctggtgtatcaccaagtatgtattcgaaaccgccgtaggatgaagccca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
49794538 |
tggtgaatggtgcatcactaagtatgtctttagaaccacgataggatgaagctggtgtatcaccaagtatgtgttcgaaaccaccgtaggatgaagccca |
49794637 |
T |
|
| Q |
218 |
gatgcacgtttctcaaactctagaaattgtaacttcatcttttca |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
49794638 |
gatgcacgtttctcaaactctagaaattgtaccttcatcttttca |
49794682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University