View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11527_high_13 (Length: 383)
Name: NF11527_high_13
Description: NF11527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11527_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 364; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 364; E-Value: 0
Query Start/End: Original strand, 4 - 367
Target Start/End: Complemental strand, 44377525 - 44377162
Alignment:
| Q |
4 |
cgggctcctgagtggtattttgctcagaaggttgactatctaaaagacaaagtggacgcggctttcatcaaggagcgtcgtgctattaaggtttgaacta |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44377525 |
cgggctcctgagtggtattttgctcagaaggttgactatctaaaagacaaagtggacgcggctttcatcaaggagcgtcgtgctattaaggtttgaacta |
44377426 |
T |
|
| Q |
104 |
attattattattggtttgccttgtatcatatctgtagtctcaaaacaaatgatggtttcattgcatttgcttgtggtgttttgaatcttgttggtacaga |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44377425 |
attattattattggtttgccttgtatcatatctgtagtctcaaaacaaatgatggtttcattgcatttgcttgtggtgttttgaatcttgttggtacaga |
44377326 |
T |
|
| Q |
204 |
gggactatgaagagttaaaagtgaggattaatgcattggttgcaatggcgcaaaaggttcctgaggatggatggacaatgcaagatgggacaccttggcc |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44377325 |
gggactatgaagagttaaaagtgaggattaatgcattggttgcaatggcgcaaaaggttcctgaggatggatggacaatgcaagatgggacaccttggcc |
44377226 |
T |
|
| Q |
304 |
tggaaacaatgtcaacgatcatcctggaatgattcaggtgagtagcgttatatgatactacttc |
367 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44377225 |
tggaaacaatgtcaacgatcatcctggaatgattcaggtgagtagcgttatatgatactacttc |
44377162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 6e-22; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 193 - 342
Target Start/End: Complemental strand, 38720769 - 38720620
Alignment:
| Q |
193 |
gttggtacagagggactatgaagagttaaaagtgaggattaatgcattggttgcaatggcgcaaaaggttcctgaggatggatggacaatgcaagatggg |
292 |
Q |
| |
|
|||| ||||||| || |||||||| || || |||||||||||| ||||| |||| ||| || |||||||| |||||||||||||| ||||| |||||| |
|
|
| T |
38720769 |
gttgttacagagagattatgaagaatttaaggtgaggattaatagtttggtggcaacggcacagaaggttcccgaggatggatggactatgcaggatggg |
38720670 |
T |
|
| Q |
293 |
acaccttggcctggaaacaatgtcaacgatcatcctggaatgattcaggt |
342 |
Q |
| |
|
|| || ||||||||||| |||| | ||||||||||| ||||||||||| |
|
|
| T |
38720669 |
actccgtggcctggaaatgatgtgagggatcatcctggcatgattcaggt |
38720620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 280 - 342
Target Start/End: Complemental strand, 13825952 - 13825890
Alignment:
| Q |
280 |
aatgcaagatgggacaccttggcctggaaacaatgtcaacgatcatcctggaatgattcaggt |
342 |
Q |
| |
|
|||||||||||| ||||| ||||||||||| ||||||| || ||||| |||||||| ||||| |
|
|
| T |
13825952 |
aatgcaagatggtacaccgtggcctggaaataatgtcagagaccatccgggaatgatccaggt |
13825890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 266 - 342
Target Start/End: Complemental strand, 49591871 - 49591795
Alignment:
| Q |
266 |
gaggatggatggacaatgcaagatgggacaccttggcctggaaacaatgtcaacgatcatcctggaatgattcaggt |
342 |
Q |
| |
|
||||| || ||||||||||| ||||| || |||||||||||||| ||| || ||||||||||||||||||||||| |
|
|
| T |
49591871 |
gaggaaggttggacaatgcaggatggaactccttggcctggaaataatcccagggatcatcctggaatgattcaggt |
49591795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 200 - 339
Target Start/End: Complemental strand, 54383453 - 54383314
Alignment:
| Q |
200 |
cagagggactatgaagagttaaaagtgaggattaatgcattggttgcaatggcgcaaaaggttcctg-aggatggatggacaatgcaagatgggacacct |
298 |
Q |
| |
|
||||| || ||||||||||| || || ||||| |||||| | || |||| || || |||||||||| |||| || |||| ||||| ||||||||||| |
|
|
| T |
54383453 |
cagagagaatatgaagagtttaaggttaggatcaatgcacttgtggcaaaagctcagaaggttcctgcaggaggg-tggattatgcaggatgggacacca |
54383355 |
T |
|
| Q |
299 |
tggcctggaaacaatgtcaacgatcatcctggaatgattca |
339 |
Q |
| |
|
||||| ||||||||| || ||||||||||| |||||||| |
|
|
| T |
54383354 |
tggccaggaaacaatactaaggatcatcctggtatgattca |
54383314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University