View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11527_high_22 (Length: 311)
Name: NF11527_high_22
Description: NF11527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11527_high_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 20 - 303
Target Start/End: Original strand, 48398881 - 48399164
Alignment:
| Q |
20 |
gtgtttagatgctcttgatattcttggacgataacttctgatgcactacatggttagtaggacctgctgcaagaactcaacaaatttgatgcttggatag |
119 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48398881 |
gtgtttagatgctctcgatattcttggacgataacttctgatgcactacatggttagtaggacctgctgcaagaactcaacaaatttgatgcttggatag |
48398980 |
T |
 |
| Q |
120 |
attttatggttcctccttgtttccagattaaacttcctacttgtgaggctggctcacgtgaaggagcatctaacccatgaattgaccgtttatgagcagg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48398981 |
attttatggttcctccttgtttccagattaaacttcctacttgtgaggctggcacacgtgaaggagcatctaacccatgaattgaccgtttatgagcagg |
48399080 |
T |
 |
| Q |
220 |
tggaaaagaagaaccaggctcatcttcagctaatatcattacctagtcaaaaagaacaaataacactatcagcctgtctctgct |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48399081 |
tggaaaagaagaaccaggctcatcttcagctaatatcattacctagtcaaaaagaacaaataacactatcagcctgtctttgct |
48399164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 57; Significance: 8e-24; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 214 - 298
Target Start/End: Complemental strand, 47652176 - 47652092
Alignment:
| Q |
214 |
agcaggtggaaaagaagaaccaggctcatcttcagctaatatcattacctagtcaaaaagaacaaataacactatcagcctgtct |
298 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||| ||| ||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
47652176 |
agcaggtggaagagaagaaccaggctcatctttggctgataccattacctaatcacaaagaacaaataacactatcagcctgtct |
47652092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 111 - 172
Target Start/End: Complemental strand, 47652330 - 47652269
Alignment:
| Q |
111 |
cttggatagattttatggttcctccttgtttccagattaaacttcctacttgtgaggctggc |
172 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
47652330 |
cttggatagattttacggtgcctccttgtttcccaattaaacttcctgcttgtgaggctggc |
47652269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 216
Target Start/End: Complemental strand, 47652233 - 47652195
Alignment:
| Q |
178 |
tgaaggagcatctaacccatgaattgaccgtttatgagc |
216 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
47652233 |
tgaaggagcatctaacccatcaattaaccgtttatgagc |
47652195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University