View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11527_high_32 (Length: 247)
Name: NF11527_high_32
Description: NF11527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11527_high_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 8 - 184
Target Start/End: Original strand, 16522525 - 16522704
Alignment:
| Q |
8 |
gaagcagagaagaagaagaccatcttttttgcacgtgtgtgttgacatctttacagtggcactgaacattt-----aattgggtgggaaaatgaatgatt |
102 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |||| ||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
16522525 |
gaagcatagaagaaga-gaccatcttttttgcacgtgtgtgttgacatctttactgtggtactgaacatttaatttaattgggtgggaacatgaatgatt |
16522623 |
T |
 |
| Q |
103 |
ttgcacgttacaattctttccctctttgattatttttctcgtcttctttgaatgccaagtgatctcttcggtgaggatggat |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
16522624 |
ttgcacgttacaattctttccctctttgattatttttct-gtcttctttgaatgccaagtgatctgttcgatgaggatggat |
16522704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University