View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11527_high_35 (Length: 234)
Name: NF11527_high_35
Description: NF11527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11527_high_35 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 30 - 211
Target Start/End: Complemental strand, 37658927 - 37658746
Alignment:
| Q |
30 |
atattaatggtagtctagtatttaacctcattagtctgatatatgagatttgatgacaggatgccatggtgaaagatacacttgaacgggctattgaacc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37658927 |
atattaatggtagtctagtatttaacctcattagtctgatatatgagatttgatgacaggatgccatggtgaaagatacacttgaacgggctattgaacc |
37658828 |
T |
|
| Q |
130 |
aaacttgaacctgagacattatcttcaggaggcatacgtacacccagtttttaagggcgatgagtttgaaaaacaagtgaac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37658827 |
aaacttgaacctgagacattatcttcaggaggcatacgtacacccagtttttaagggcgatgagtttgaaaaacaagtgaac |
37658746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University