View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11527_low_25 (Length: 301)
Name: NF11527_low_25
Description: NF11527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11527_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 29 - 286
Target Start/End: Complemental strand, 4477712 - 4477433
Alignment:
| Q |
29 |
gagttaaattatgagttaaacagacgttgtgggagttgcttgatcgatcaatcacaatatcttgataggagatgcaaatagtttccacatctc--aacca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4477712 |
gagttaaattatgagttaaacagacgttgtgggagttgcttgatcgatcaatcacaatatcttgataggagatgcaaatagtttccacatctcataacca |
4477613 |
T |
 |
| Q |
127 |
aacatgcacaaaatctataaaaacgacaattacag--------------------cacattaaaagtgtggagttatttgtatattttgaaactaatatg |
206 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4477612 |
aacatgcacaaaatctataaaatcgacaattacagccttcatgaagtgtatatttcacattaaaagtgtggagttatttgtatattttgaaactaatatg |
4477513 |
T |
 |
| Q |
207 |
accattgtttatgcaccaaaacaaaggtttactcgatattgcaattgtgtccctacatttggtgtacatgctttccgtgt |
286 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4477512 |
accattgtttatgcacgaaaacaaaggtttactcgatattgcaattgtgtccctacatttggtgtacatgctttctgtgt |
4477433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University