View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11527_low_26 (Length: 296)
Name: NF11527_low_26
Description: NF11527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11527_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 19 - 287
Target Start/End: Complemental strand, 33160257 - 33159989
Alignment:
| Q |
19 |
actaggagcattgctttcagaacttgtttggaactggaaatatcataccaaaaaggtgcttcttagtttttcacctcatagctgtttctcattgttaggc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33160257 |
actaggagcattgctttcagaacttgtttggaactggaaatatcataccaaaaaggtgcttcttagtttttcacctcatagctgtttctcattgttaggc |
33160158 |
T |
 |
| Q |
119 |
atgattgatttttgatcaattatttctttggtggaatgcagatttcagaagtagcatcattcgtctttatctttgtgtgcaacttcctccttggttttct |
218 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33160157 |
atgattgatttttgatcaattttttctttggtggaatgcagatttcagaagtagcatctttcgtctttatctttgtgtgcaacttcctccttggttttct |
33160058 |
T |
 |
| Q |
219 |
gccttatgtagacaatttttcaagcattggaggttttatatcaggattcctccttggaactgttcttct |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33160057 |
gccttatgtagacaatttttcaagcattggaggttttatatcaggattcctccttggaactgttcttct |
33159989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University