View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11527_low_29 (Length: 258)
Name: NF11527_low_29
Description: NF11527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11527_low_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 33239812 - 33239612
Alignment:
| Q |
1 |
atagaataaatatccaatttggtttcaaatccaatttgctcgcggctgaattcaatccatcacaaaaaatattatccaaattagtcagtgacattttcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33239812 |
atagaataaatatccaatttggtttcaaatccaatttgctcgcggctgaattcaatccatcagaaaaaatattatccaaattagtcagtgacattttcat |
33239713 |
T |
 |
| Q |
101 |
acaagaaacaaattattctctcttttaatttgacacattttcacttagtgactaatttgtcccacaaataaaataaaaatgtcaaaagactaattctgta |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33239712 |
acaagaaacaaattagtctctcttttaatttgacacattttcacttagtgactaatttgtcccacaaataaaataaaaatgtcaaaagactaattttgta |
33239613 |
T |
 |
| Q |
201 |
t |
201 |
Q |
| |
|
| |
|
|
| T |
33239612 |
t |
33239612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University